🧬 Molecular Biology

Interactive simulator of molecular life processes

DNA Structure

5' - ATGCGTACGTATGCAACGGTTA - 3'
3' - TACGCATGCATACGTTGCCAAT - 5'
21

Nucleotides

A - Adenine (purine base)

T - Thymine (pyrimidine base)

G - Guanine (purine base)

C - Cytosine (pyrimidine base)

Transcription: DNA → RNA

Template DNA

3' - TACGCATGCATACGTTGCCAAT - 5'

mRNA (product)

5' - AUGCGUACGUAUGCAACGGUUA - 3'

RNA Polymerase

Enzyme that synthesizes RNA

Translation: RNA → Protein

mRNA

5' - AUGCGUACGUAUGCAACGGUUA - 3'

Amino Acid Sequence

Met Arg Thr Met Gln Arg Leu

Ribosome

Organelle for protein synthesis

Genetic Code

UUU→Phe, UUC→Phe, UUA→Leu, UUG→Leu

UCU→Ser, UCC→Ser, UCA→Ser, UCG→Ser

UAU→Tyr, UAC→Tyr, UAA→Stop, UAG→Stop

UGU→Cys, UGC→Cys, UGA→Stop, UGG→Trp

CUU→Leu, CUC→Leu, CUA→Leu, CUG→Leu

CCU→Pro, CCC→Pro, CCA→Pro, CCG→Pro

CAU→His, CAC→His, CAA→Gln, CAG→Gln

CGU→Arg, CGC→Arg, CGA→Arg, CGG→Arg

AUU→Ile, AUC→Ile, AUA→Ile, AUG→Met

ACU→Thr, ACC→Thr, ACA→Thr, ACG→Thr

AAU→Asn, AAC→Asn, AAA→Lys, AAG→Lys

AGU→Ser, AGC→Ser, AGA→Arg, AGG→Arg

GUU→Val, GUC→Val, GUA→Val, GUG→Val

GCU→Ala, GCC→Ala, GCA→Ala, GCG→Ala

GAU→Asp, GAC→Asp, GAA→Glu, GAG→Glu

GGU→Gly, GGC→Gly, GGA→Gly, GGG→Gly

Protein Structure and Functions

Protein Functions

• Catalytic (enzymes)

• Structural (collagen)

• Transport (hemoglobin)

• Defense (antibodies)

• Regulatory (hormones)

FAQ - Frequently Asked Questions

1. What is the difference between DNA and RNA?

+

DNA (deoxyribonucleic acid) is a double-stranded molecule that contains genetic information. It consists of nucleotides A, T, G, C and has deoxyribose sugar. RNA (ribonucleic acid) is usually single-stranded, contains nucleotides A, U, G, C (uracil U instead of T) and has ribose sugar. RNA is less stable than DNA and performs various functions: mRNA transfers information, tRNA transports amino acids, rRNA is a structural component of ribosomes.

2. How does transcription work?

+

Transcription is the process of RNA synthesis using DNA as a template. It consists of three stages: 1) Initiation: RNA polymerase binds to the promoter (gene start region) and opens the DNA double helix. 2) Elongation: RNA polymerase moves along DNA, synthesizing RNA in the 5'→3' direction following the complementarity principle. 3) Termination: synthesis ends at terminator sequences, RNA separates from DNA.

3. What is the genetic code and why is it universal?

+

The genetic code is a system of rules by which nucleotide triplets (codons) in mRNA correspond to specific amino acids in proteins. The code is triplet (3 nucleotides = 1 amino acid), degenerate (several codons can code for one amino acid), non-overlapping and practically universal for all living organisms. The universality of the code indicates a common origin of all life on Earth and allows using genes from one organism in others (basis of genetic engineering).

4. How does the ribosome work during translation?

+

The ribosome is a molecular machine for protein synthesis. It consists of two subunits (large and small) and has three active sites: A-site (aminoacyl - for incoming new tRNA), P-site (peptidyl - where the growing peptide is located), E-site (exit - for outgoing used tRNA). The ribosome reads mRNA by codons, ensures accuracy of codon-anticodon pairing and catalyzes formation of peptide bonds between amino acids.

5. What is alternative splicing?

+

Alternative splicing is a process by which different variants of mature mRNA can be obtained from one primary transcript (pre-mRNA) by including or excluding certain exons. This allows one gene to encode several different proteins (isoforms) with different functions. In humans, over 90% of genes undergo alternative splicing, significantly increasing protein repertoire diversity with a relatively small number of genes (~20,000).

6. How do proteins acquire their functional structure?

+

Proteins have four structural levels: Primary - amino acid sequence determined by the gene. Secondary - local structures (α-helices, β-sheets) through hydrogen bonds. Tertiary - three-dimensional structure through various interactions (hydrogen bonds, ionic interactions, disulfide bridges, hydrophobic interactions). Quaternary - interaction of multiple polypeptide chains. Folding occurs spontaneously according to the minimum energy principle, often with the help of chaperones.

7. What are enzymes and how do they accelerate reactions?

+

Enzymes are protein catalysts that accelerate biochemical reactions without changing product energy. They lower the activation energy of reactions by providing an alternative mechanism. The enzyme has an active site that is complementary to the reaction's transition state. According to the "induced fit" model, the substrate changes enzyme conformation upon binding. After the reaction, the product is released and the enzyme returns to its initial state. One enzyme molecule can catalyze thousands of reactions per second.

8. How does the cell regulate gene expression?

+

Gene expression is regulated at several levels: Transcriptional: promoters, enhancers, silencers, transcription factors control transcription initiation. Post-transcriptional: splicing, RNA editing, microRNA affect mRNA processing. Translational: mRNA structures, ribosomal proteins, microRNA regulate protein synthesis. Post-translational: protein modifications (phosphorylation, ubiquitination) change their activity and stability. This allows cells to quickly respond to changing conditions.

9. What is DNA replication and when does it occur?

+

DNA replication is the process of doubling genetic material before cell division. It occurs in the S-phase of the cell cycle. The process is semi-conservative: each new DNA molecule contains one old and one new strand. Main enzymes: helicases (unwind the helix), DNA polymerases (synthesize new strands), ligases (join fragments). The leading strand is synthesized continuously, the lagging strand - in Okazaki fragments. Accuracy is ensured by polymerase proofreading activity and repair systems.

10. What are modern methods for studying molecular biology?

+

Modern molecular biology uses powerful methods: Next-generation sequencing (NGS) for determining DNA/RNA sequences; CRISPR/Cas9 for gene editing; Cryo-electron microscopy for studying macromolecular structures; Fluorescence microscopy for observing processes in living cells; Mass spectrometry for protein analysis; ChIP-seq for studying protein-DNA interactions; Single-cell RNA-seq for analyzing gene expression in individual cells. These methods have revolutionized our understanding of life at the molecular level.